New Thread
Reply
 
Previous page | 1 | Next page
Print | Email Notification    
Author

Con gli occhi della Scienza - Biologia

Last Update: 9/2/2009 5:35 AM
OFFLINE
Email User Profile
Post: 3,402
Post: 2,626
Gender: Male
Master User
Cardinale
5/25/2007 1:00 AM
 
Quote

I recenti dibattiti mi hanno convinto di quanto sarebbe importante riuscire a mettere in chiaro alcuni aspetti fondamentali di una materia che, collateralmente al mio percorso di studi, ho il privilegio di poter approfondire: le scienze biologiche.
Il fatto è che mi sono accorto da tempo che tutti i temi più importanti nell’etica moderna, così dibattuta da politici, filosofi, religiosi e a volte anche da scienziati, appartengono spesso e volentieri proprio alla sfera della biologia. Uso questo termine impropriamente: medicina, citologia, istologia, anatomia, fisiologia, genetica, biochimica e molte altre materie sono in molti casi le reali fonti di informazioni utili. Sia a causa di argomenti dove il contributo di queste materie è essenziale (come la nozione scientifica di embrione, la teoria dell’evoluzione, il concetto di OGM, il diritto all’aborto, la contraccezione pre e post-fecondazione e così via) o semplicemente quando si trovano loro malgrado a portare un contributo significativo (come per esempio nella definizione di omosessualità), è innegabile che in quest'epoca le scienze biologiche si trovino a fare spesso e volentieri la parte del leone sulla scena del dibattito pubblico. E’ a partire da esse, e solo usandole correttamente, che risulta poi possibile formarsi un’opinione corretta in merito ai temi della cosiddetta “bioetica”.
Per questo mi sento in dovere di cercare, con tutti i mezzi a mia disposizione, di spiegare alcune cose a beneficio di chi non ha avuto l’opportunità che ho avuto io di studiarle sul campo.
Non ho intenzione di affrontare dibattiti, qui. Non esprimerò opinioni personali e non affronterò temi ideologici o di attualità. Parlerò invece di concetti scientifici generali, utili alla cultura della persona e alla comprensione della realtà biologica che ci circonda, ed esporrò le loro più elementari conseguenze logiche.
Tutti i concetti di cui tratterò qui hanno ricevuto dimostrazioni empiriche e giustificazioni teoriche al di là di ogni ragionevole dubbio. Qualsiasi ipotesi scientifica priva di dimostrazione o in fase di convalida che volessi riportare, sarà indicata come tale.
Di certo io non sono un maestro (né tanto meno chi mi legge è un allievo) quindi spero che possiate perdonare i miei errori espositivi. Chi mi ha già letto sa quanto io tenga ad esplicitarmi con la massima chiarezza; la mia disponibilità per spiegazioni, anche tramite messaggi privati, è sempre valida. Purtroppo qui so già che avrò grosse difficoltà espositive, perché cercherò di trasmettervi una visione scientifica delle cose, più che un semplice insieme di nozioni teoriche. E non sarà facile: da parte mia ho impiegato anni per acquisirla; ma mi piace comunque credere che potrò riuscire a trasmettervi, se non tutti, almeno alcuni concetti critici.
Con il permesso dello staff, invio questa trattazione in una sezione dove non è concesso postare, per il semplice fatto che non intendo permettere a persone che dovessero trovare ideologicamente sconvenienti queste realtà scientifiche, di inquinare il valore espositivo del thread.
Ripeto però che sono sempre pronto a dibattiti e chiarimenti nelle sedi apposite.
Per chi è interessato quindi, cominciamo…



NOTA: avviso che i post possono essere soggetti a modifiche e aggiunte, sulla base delle richieste di spiegazioni degli utenti. Mi auguro di perfezionare la forma espositiva di questi post, con il passare del tempo e l'aiuto dell'utenza.
[Edited by Rainboy 9/2/2009 6:40 AM]
OFFLINE
Email User Profile
Post: 3,402
Post: 2,626
Gender: Male
Master User
Cardinale
5/25/2007 1:06 AM
 
Quote

DISCORSI GENERALI CIRCA LA NATURA DEL DNA, IL RUOLO DEL CODICE GENETICO E DELL’INFORMAZIONE EREDITARIA
parte I



"D.N.A."

Che cosa vi hanno insegnato su questa molecola?
Saprete che la sigla sta per Desoxiribo-Nucleic Acid, acido desossiribonucleico. Sicuramente vi avranno detto anche che contiene il nostro patrimonio genetico, il quale definisce l’appartenenza ad una razza e caratterizza tutto ciò che siamo fisicamente; probabilmente saprete anche che ogni essere umano ha un DNA la cui sequenza è nel complesso unica e irripetibile, e che se questa sequenza contiene degli “errori”, delle mutazioni, la cosa può essere molto grave e causare malattie genetiche, tumori e così via.
Anche la sua forma poi è entrata nell’immaginario collettivo: una specie di doppia elica, o piuttosto una scala a pioli contorta su sé stessa, che trasporta una sequenza infinita di quattro gruppi chimici chiamati “basi azotate”, rappresentati da quattro lettere… Adenina, Timina, Guanina, Citosina. A, T, G, C.
E ogni base azotata, legata alla sua personale molecola di zucchero (il desossiribosio) e al suo personale gruppo fosforo, costituisce una subunità molecolare definita “nucleotide”: in pratica un anello della catena del DNA.
Queste cose sono di dominio pubblico.
Molta gente però vede il DNA come una specie di lungo e magico nastro forato, scritto apposta con il solo scopo di essere letto dalla cellula, e contenente tutte le istruzioni per la costruzione di un determinato individuo; si tende a pensare inoltre al DNA come a qualcosa che “basta a sé stesso”: il DNA è una specie di factotum che avendo immagazzinata tutta la conoscenza genetica, è la fonte delle azioni stesse della cellula; si crede anche che la cellula gli obbedisca ciecamente, che tutto ciò che lo circonda non siano altro che dei robot che eseguono i suoi comandi; e da questo si deduce che essendo il DNA uguale in ogni cellula di un dato organismo, di fatto può essere visto come la rappresentazione molecolare dell’individuo di cui fa parte.
Si pensa infine che il DNA sia, esso stesso, il patrimonio genetico che trasporta. Se io ora scrivessi una sequenza di basi azotate di DNA, come ad esempio “ATTTAGACCTCCGTCAGGGTTA”, molti penserebbero che – se questa sequenza è reale ed è stata tratta da un vero DNA – allora essa ha necessariamente un significato informativo; insomma lì sopra c’è scritto un frammento di “qualche cosa” che qualcuno dotato dei giusti mezzi “potrebbe leggere”.
Ma tutto questo è concettualmente errato. Si basa su una visione semplicistica e disinformativa, che molti trovano utile per divulgare o più spesso per diffamare... a partire dai giornalisti italiani, che hanno demeriti enormi in fatto di informazione scientifica. Prima di entrare nei dettagli, analizziamo i fatti che hanno causato questo fraintendimento.
Vi ricordate a scuola, i rudimenti della sintesi proteica?
Molti decenni or sono, quando si scoprì il ruolo del DNA come "portatore" dell'informazione genetica (una prima prova sperimentale venne nel 1944, con l'esperimento di Avery; la dimostrazione definitiva fu nel 1952, con l'esperimento di Hersey e Chase) nessuno ancora aveva inventato il concetto moderno di codice genetico; quindi dopo aver stabilito la sua forma tridimensionale (nel 1953, ad opera di Watson, Crick, Wilkins e Franklin) la prima cosa che gli scienziati dell’epoca scoprirono con i limitati mezzi che avevano a disposizione, fu che esisteva una corrispondenza molto specifica fra determinati gruppetti di basi azotate – composti sempre da tre basi ciascuno – e alcuni amminoacidi, i costituenti primari delle proteine, ovvero il prodotto che costituisce fisicamente i tessuti degli esseri viventi.
Ad esempio la prima corrispondenza che si trovò (nel 1961 ad opera di Niremberg e Matthaei) fu che “TTT”, ovvero “Timina, Timina, Timina” che tradotto nell’RNA era “UUU”, ovvero “Uracile, Uracile, Uracile” corrispondeva all’aggancio di un amminoacido chiamato Fenilalanina.
Ci sono milioni di amminoacidi possibili secondo le regole della chimica organica; ma le forme di vita su questo pianeta ne utilizzano soltanto venti (ventidue in alcuni rari casi).
E si scoprì, guarda caso, che tutte le triplette possibili con i 4 caratteri usati universalmente dal DNA, ovvero tutte le 4x4x4 = 64 combinazioni possibili con le lettere A,T,C,G, erano capaci di agganciare un loro amminoacido. E non uno qualunque, ma solo uno di quei venti amminoacidi vitali: ogni tripletta poteva agganciarne uno, che poteva essere lo stesso di un’altra tripletta (il codice genetico si dice in biologia che è RIDONDANTE), ma nessuna tripletta poteva mai avere più di un singolo amminoacido riconoscibile (il codice genetico si dice in biologia che è NON AMBIGUO). L’unica eccezione erano le triplette di “stop”, che avevano comunque un significato strettamente legato a quello della proteina in cui venivano usate.
Era così che la cellula poteva sempre sapere come costruire le sue proteine; ogni proteina, nella sua struttura primaria (la sua forma monodimensionale) non è altro che una lunga catena di amminoacidi, che vengono legati l’uno in fila all’altro con grande precisione durante il processo della sintesi proteica; si sapeva già che tutte le proteine potevano teoricamente essere ridotte a dei lunghissimi “fili” arrotolati ad arte su sé stessi, e si comprese che la loro “tessitura” (sintesi) avveniva fuori dal nucleo, in dei siti catalitici appositi chiamati ribosomi; essa era possibile solo grazie allo “stampo” fornito dall’RNA, che a sua volta proveniva dal nucleo, dove era stato copiato (trascritto) integralmente da quello del DNA. Quest’ultimo era quindi la grande banca dati; lo si poteva pensare come una sorta di lunghissima stringa informativa dove erano memorizzate e codificate con l'alfabeto a triplette tutte le sequenze di tutte le proteine utili alla cellula, cosa che rendeva possibile la produzione di ciò che è necessario alla sopravvivenza.
Il raggiungimento di questa visione delle cose, per gli scienziati era l'anello mancante che completava una lunga catena di eventi; perché la sintesi proteica, come sappiamo da circa un secolo, è la base della vita.
Le proteine sono impiegate in qualsiasi funzione metabolica; molte di esse sono enzimi, cioè dispositivi chimici che con la loro particolare forma catalizzano tutte le nostre reazioni chimiche interne, velocizzandole o inibendole per modularle fra loro e mantenere una perfetta omeostasi – l’equilibrio chimico ideale fra i distretti interni ed esterni di una cellula. Altre proteine sono invece proteine strutturali, che costituiscono fisicamente le strutture e gli organuli della cellula; altre ancora sono proteine di membrana, o proteine destinate alla secrezione, proteine leganti, proteine di riconoscimento, proteine solventi, proteine litiche (distruttive). E così via, con una lista che potrebbe durare pagine intere.
Le proteine hanno tutti i ruoli metabolici possibili e immaginabili, e per questo la loro sintesi è l’attività anabolica primaria della cellula. “Anabolismo” è inteso come l’insieme di tutte le reazioni chimiche che portano alla costituzione di composti complessi partendo da elementi o composti più semplici; ogni processo anabolico richiede energia, e non avviene spontaneamente ma deve essere catalizzato. Naturalmente l’energia deve venire da qualche parte. Gli esseri viventi che non sono autotrofi, quindi quelli incapaci di costruire spontaneamente zuccheri sfruttando gli elementi inorganici e l’energia solare, devono acquisire energia “rubando” molecole utili ad altri organismi. In pratica, divorando questi organismi per assimilare i prodotti già presenti nei loro tessuti. I processi anabolici sono possibili solo grazie all’esistenza di contro-processi, detti processi catabolici, che consistono nella distruzione mediata di zuccheri e altre molecole, le quali vengono “bruciate” assieme all’ossigeno, per ricavarne energia chimica. I mediatori catalitici di questo processo, ovviamente, sono ancora una volta le proteine. Anche gli amminoacidi essenziali, cioè quelli che non siamo in grado di sintetizzare da soli, vengono acquisiti soltanto denaturando e distruggendo le proteine dei tessuti degli esseri viventi da noi mangiati, e anche questo avviene ad opera di enzimi proteici specializzati.
E’ un circolo chiuso insomma: il catabolismo, l’insieme di tutti i processi che generano la formazione di molecole più semplici (ed energia chimica) a partire da molecole più complesse, è direttamente dipendente dall’esistenza delle giuste proteine nella cellula; ma le proteine nella cellula vengono sintetizzate anabolicamente, usando l’energia e gli amminoacidi acquisiti dalle precedenti reazioni cataboliche. Ognuno dei due cicli alimenta l’altro, in un cerchio senza fine di sintesi e distruzione mediato dalle proteine.
Fatte queste premesse, si può dire a buon diritto che chi controlla la sintesi proteica, controlla la vita.
E da chi provengono queste informazioni? Dal DNA.
Sembra tutto facile, giusto? I principi chiave sembrano esserci tutti. Ma queste sono conoscenze che erano già ben note negli anni ’60. Dobbiamo dedurne che oggi tutti i biologi molecolari sono diventati dei mangia-pane a tradimento?
No, invece i loro (magrissimi) stipendi se li guadagnano eccome.
Ora vediamo perché.

L'espressione genica

Il discorso che segue è dedicato specificamente alle cellule eucarioti umane; tenterò di darvi una prima infarinatura del concetto di “espressione genica”, partendo da basi molto pratiche.
In una cellula eucariote umana, la cui dimensione media si aggira fra 15 e i 25 micron (cioè millesimi di millimetro), il DNA diploide contenuto nel nucleo è la somma di 46 diverse molecole.
La forma di ognuna di queste molecole è in pratica quella di un filamento contorto; esse, se fossero distese una davanti all’altra per formare un unico filamento, sarebbero all’incirca 2 x 3,2 x 10^9 = 6.400.000.000 basi azotate consecutive. Che corrispondono a una lunghezza di oltre due metri.
Sono tutte contenute nel nucleo, una struttura di forma sferica o schiacciata che raggiunge i 5-10 micron di diametro.
Avete capito bene: una cellula possiede, in un nucleo largo al massimo 10 micron, due metri di molecola di DNA.
Considerato che un corpo umano adulto è composto mediamente da 60.000.000.000.000 (sessantamila miliardi) di cellule interagenti fra loro, se distendessimo tutto il nostro DNA potremmo tranquillamente farlo arrivare oltre i confini più remoti del sistema solare.
E non è solo una questione di dimensioni, ma anche di massa; si può dire, con ineccepibile correttezza, che se facessimo quel giochino che spesso si fa ai bambini – “il 70% del tuo corpo è composto da acqua, quindi potresti immaginare di essere pieno di acqua a partire dai piedi fino allo stomaco…” – beh, se lo facessimo parlando dei nostri composti chimici, allora una parte tutt’altro che trascurabile del nostro corpo (quasi un chilo) sarebbe “riempita” fisicamente di solo DNA.
Provate adesso ad immaginarvi le difficoltà di stoccaggio di questa macro-molecola, costituita da 46 enormi sub-unità (i filamenti che poi durante la replicazione della cellula, si osserveranno sotto forma di cromosomi) nello spazio esiguo del nucleo di una cellula.
Avrete già capito che è ridicolo pensare di mantenerla dritta: sfonderebbe da tutte le parti. Dovrete piegarla, e dovrete farlo moltissime volte; centinaia di migliaia di volte.
Il problema è che dovrete piegarla a forza, perché il DNA usa, come collante fra le basi azotate, dei gruppi fosforo (quattro atomi di ossigeno ai lati, tenuti assieme da un atomo di fosforo centrale) e questo gruppo atomico è elettricamente carico, quindi tende a respingersi; pertanto il DNA tende spontaneamente a raddrizzarsi, e voi non potrete semplicemente piegarlo e lasciarlo lì: dovrete metterlo in ceppi, imprigionarlo, in modo che non si possa muovere.
Ma naturalmente, se vi limitate a metterlo in ceppi, sarà tutto perfettamente inutile: il DNA voi dovete poterlo srotolare e leggere, altrimenti che cosa ve ne fate?
Dovrà quindi esistere un sofisticato sistema che incatena molte parti di DNA, ma ne lascia libere alcune – soltanto quelle che servono – perché possano essere lette; e questo sistema dovrà essere eccezionalmente versatile, perché le parti di DNA che servono alla cellula non sono certamente sempre le stesse – altrimenti non sarebbe così lungo! In qualsiasi momento, si potrebbe aver bisogno di una parte che è immobilizzata; bisognerà che il sistema riconosca chimicamente la necessità di liberarla, che la liberi, che la trascriva, che mantenga lo status quo (evitando di liberare troppo DNA in una volta sola), che riconosca il momento in cui quel pezzo non serve più e lo rimetta in catene; e perché tutto questo abbia un senso, bisognerà tenere presente che il DNA è tutto fuorché una sequenza lineare di informazioni utili!
I geni costituiscono soltanto il 20-30% della lunghezza complessiva del nostro DNA, dal che si evince quanto sia sciocco sovrapporre il concetto di DNA umano a quello di genoma umano, senza fare i dovuti distinguo. Un esempio? Molte parti del DNA ad esempio non contengono informazioni, ma servono come siti di legame per rendere materialmente possibile l’inizio dell’attività degli enzimi di trascrizione (per permettere quindi la copiatura del DNA in tante copie di RNA messaggero, che andrà a fare la sintesi proteica) o degli enzimi responsabili della duplicazione semiconservativa (ricordiamoci che duplicare l'informazione genetica è il requisito essenziale perché la cellula si prepari a dividersi).
Ci sono anche porzioni di DNA che milioni di anni fa erano geni, ma con l'evolversi della specie sono diventate inutili e, abbandonate a sé stesse, hanno perso ogni significato, diventando dei relitti evolutivi (i cosiddetti pseudogeni); sono tantissime, per un totale di decine, centinaia di milioni di basi.
Altre porzioni invece sono fatte apposta per assecondare necessità meccaniche: non trasportano informazioni di sorta, ma i loro componenti sono particolarmente "malleabili" e servono per permette agli enzimi di aprire e srotolate quel tratto di doppia elica. E per lo stesso motivo, esistono poi molte sequenze definite “di consenso” che devono potersi legare agli enzimi per “avvallare” la trascrizione di geni particolari.
Del resto ci sono anche lunghe sequenze assolutamente prive di significato, interposte per rendere possibile che un determinato gene si trovi in un punto esatto del genoma, oppure altre poste in determinati punti per casualità, come degli errori di replicazione ancestrali che non furono mai corretti, o delle infezioni virali. Ci sono, infine, le distinzioni fondamentali da fare anche all’interno dei geni stessi, su cosa è utile e cosa no; ma di quest’ultimo aspetto, che è troppo importante per poter essere citato di sfuggita, ci preoccuperemo in un secondo momento.
Ora torniamo al ragionamento precedente. I meccanismi che presiedono all’espressione del genoma, sono ancora oggetto di studio e lo saranno per molti decenni. Molto si è scoperto, e molto resta ancora da scoprire.
Sappiamo che una grande quantità di geni trascrivono per proteine enzimatiche che hanno attività nel nucleo; quindi proteine il cui solo scopo è quello di modulare l’azione degli altri enzimi trascrizionali e di conseguenza, la trascrizione del genoma stesso.
Ma quando dico “modulare”, forse non rendo abbastanza bene il concetto.
La modulazione è il cuore del concetto di espressione genica. Un gene non è né un’informazione lineare, né soprattutto un’entità che ha il potere di scegliere quando viene trascritta. Un gene è “cieco”, perché il DNA è solo una molecola, peraltro priva di meccanismi di modificazione allosterica (tradotto: non può "cambiare forma" in relazione alle condizioni ambientali. E' costruita per restare sembre uguale a sé stessa e degenerare il meno possibile). Quindi il DNA è privo della capacità di essere informato degli eventi ambientali esterni e ha un comportamento “inerte”, anche la trascrizione è un processo per lui del tutto passivo.
Ne consegue che non è mai dai geni in sé, che dipende la reazione di adattamento ambientale di una cellula: sono invece i sofisticati meccanismi a cascata che collegano (a volte in modo molto contorto) le proteine recettrici della membrana cellulare agli enzimi trascrizionali all’interno del nucleo, che “informano” l'organismo delle necessità esterne; e quando parlo di informazione, di nuovo mi riferisco a una questione di antagonismi meccanici.

Detta così questa cosa può essere poco intuitiva. Quindi ora abbandono per un attimo il discorso sul complesso genoma umano e faccio un esempio molto semplice, per rendere tutto più chiaro. Qualcuno di voi, se ha fatto un buon liceo scientifico, forse lo ha già trattato.
Nel nostro intestino, oltre al Bifidus tanto pubblicizzato dagli spot dell’Activia, vive anche un batterio chiamato Escherichia Coli. E’ un organismo procariote piuttosto semplice, che il nostro corpo tollera perché ha sviluppato con noi una piccola simbiosi: lui si nutre di lattosio, uno zucchero tipico del latte; lo digerisce e lo processa in galattosio, uno zucchero più semplice, ricavandoci una piccola quota di energia (sotto forma di un po' di glucosio), sufficiente per vivere. Noi possiamo quindi raccogliere il galattosio, che è più facilmente digeribile, e assorbirlo dai villi.
Sembra tutto idilliaco, ma l’E.Coli ha un problema: noi il latte lo beviamo, se gli va bene, due volte al giorno; quindi il lattosio arriva in pochi momenti della giornata, in modo discontinuo e con dei picchi piuttosto bruschi. E.Coli è in possesso di un gene che codifica per un enzima, detto beta-galattosidasi, che gli permette di processare il lattosio in galattosio; ma se questo gene fosse permanentemente trascritto, quantità enormi di energia sarebbero sprecate per produrre costantemente molecole di questa proteina, con futile scopo. Allora, E.Coli ha sviluppato un sistema di controllo: il gene che codifica per la beta-galattosidasi ha una sequenza a monte della striscia che codifica per la proteina; questa sequenza è detta “sequenza operatrice”, e serve a dare agli enzimi di trascrizione l’autorizzazione: essi possono agganciarsi per sintetizzare RNA da quel gene, soltanto se prima sono passati ad acquisire le informazioni di questa sequenza.
La sequenza operatrice, in condizioni di quiete, è coperta da una proteina. Questa proteina è un inibitore di trascrizione, cioè una molecola che la rende inavvicinabile dagli enzimi di trascrizione; il gene pertanto non può essere trascritto.
Quando però arriva il latte nell’intestino, ecco che i recettori sulla membrana di E.Coli registrano un picco di lattosio; aprono i pori e iniziano a farlo entrare. Il lattosio penetra nella cellula, sconvolgendo l’omeostasi dei composti chimici al suo interno; e una molecola di lattosio finirà inevitabilmente per andarsi a trovare nella zona in cui c’è il gene della beta-galattosidasi (nei procarioti una cosa simile è più facile perché non c’è il filtro costituito dal nucleo della cellula. I procarioti del resto non hanno distretti interni delimitati da membrane. Potete immaginare un meccanismo analogo negli eucarioti, dove l’informazione viene portata dentro il nucleo da un segnale chimico specializzato).
A questo punto, la molecola di lattosio finisce per agganciarsi alla proteina inibitrice della trascrizione, quella che copriva la sequenza promotrice del gene; le due molecole, guarda caso, sono complementari, e non appena si legano, la forma dell’inibitore viene modificata, togliendogli aderenza dal DNA che prima ricopriva. A questo punto la sequenza di promozione è libera, e il primo enzima di trascrizione che passa in quel settore può iniziare ad esprimere il gene.
Viene quindi prodotto RNA messaggero codificante per la beta-galattosidasi, e questa proteina inizia nel giro di qualche minuto ad essere sintetizzata in massa da tutti i ribosomi; presto le sue molecole invadono il citoplasma della cellula di E.Coli e iniziano a processare il lattosio, riducendolo a galattosio e ricavandone energia chimica. Inevitabilmente aumenta la concentrazione di galattosio, ma diminuisce rapidamente quella di lattosio. Alla fine il gradiente di concentrazione del lattosio sarà così basso, che anche la molecola di lattosio che era legata all’inibitore di trascrizione arriverà a staccarsi e sarà processata; ma a quel punto l’inibitore riacquisterà la sua forma originale, tornerà a coprire la sequenza promotrice del gene e a bloccarne la trascrizione.
La beta-galattosidasi smetterà quindi di essere trascritta e sintetizzata. Il galattosio “di scarto” diffonderà in gran parte verso l’esterno (eventualmente i residui verranno buttati fuori a forza o riciclati in qualcosa d'altro, come è prassi per qualsiasi sostanza sgradita) e tutto tornerà come era prima; l’omoestasi verrà ripristinata. Il glucosio utile ricavato dal processo magari permetterà ad E.Coli di fare qualcosa – tipicamente riprodursi – o semplicemente di sopravvivere e aspettare, fino a che noi berremo la prossima tazza di latte.
Questo è un meccanismo di feedback negativo molto elementare; prende il nome di "operone lattosio di E. Coli" e per spiegarne il concetto l'ho a mia volta semplificato parecchio, visto che l'operone completo non include soltanto la beta-galattosidasi, ma è un gruppo di 3 geni che agiscono in modo cooperativo per riuscire a portare a termine la scissione del lattosio (due enzimi e una proteina "legante") la cui attività è sottoposta non soltanto al meccanismo lattosio-dipendente che abbiamo citato, ma anche ad altri analoghi fattori regolatori.
Ma credo che renda bene l'idea. Del resto, anche se più o meno tutti i geni nel genoma di qualsiasi organismo hanno delle proprie sequenze promotrici e un comportamento di base molto simile, gli eucarioti (nel cui regno sono annoverati tutti gli organismi pluricellulari) hanno delle versioni di controllo dell’espressione genica di fronte alle quali questo sistema procariote sembra soltanto un gioco per bambini.
Traiamo, adesso, le conclusioni dal nostro ragionamento.
Nessuno potrebbe disputare che il DNA, in questo caso rappresentato dal gene per la beta-galattosidasi, abbia avuto un ruolo chiave nel processo metabolico che abbiamo osservato. Ma la sua funzione non era altri che quella di "esistere"; l’attività metabolica è all’origine di ogni cosa – l’acquisizione dell’informazione, la reazione mirata, il ripristino dell’omeostasi – e questi sono fenomeni sui quali il DNA non può esercitare alcun controllo diretto. Sono d’altronde fenomeni adattativi: non sarebbero mai successi se non fosse avvenuto il picco di lattosio nell’ambiente esterno. Ad esso è conseguita poi la reazione degli enzimi nucleari che, opportunamente stimolati, hanno “adattato” le informazioni geniche in loro possesso alla situazione corrente, competendo meccanicamente fra loro in modo tale da scegliere il gene giusto nel momento giusto.
Questo è uno dei motivi per cui qualsiasi forma di riduzionismo legata al DNA, sia da un punto di vista biologico che in campo filosofico, è profondamente fuorviante. In un qualsiasi individuo mono o pluricellulare che utilizza la riproduzione sessuata, l’identità genetica è qualcosa di virtualmente unico (con rare eccezioni); è certamente basilare per la sua vita e contiene informazioni molto importanti su ciò che strutturalmente è; tuttavia, già a partire dalle singole cellule e soprattutto all’aumentare della complessità fisica degli organismi, il genoma è lungi dal rappresentare l’identità individuale di un essere vivente. Nei mammiferi superiori poi, culminando con l’uomo e la sua eccezionale evoluzione del cervello, lo sviluppo di facoltà interattive complesse (come la mente umana) rende l’equivalenza fra la genetica individuale e la definizione di “persona” addirittura risibile.

Nel prossimo post approfondiremo alcune scoperte che sono state fatte sull’espressione genica. Vedremo come negli eucarioti, il concetto di gene e quello di regolazione genica abbiano assunto un ruolo e una forma stupefacenti, costruendo qualcosa che trascende l’attività del codice genetico ed estende la nostra concezione di “informazione ereditaria” ben al di là dei confini dettati da quell’elegante polimero che è la molecola di acido desossiribonucleico.

Spero di non avervi annoiato, e di essere stato capace di arricchire la vostra comprensione dell’argomento.
[Edited by Rainboy 8/28/2009 12:57 AM]
OFFLINE
Email User Profile
Post: 3,402
Post: 2,626
Gender: Male
Master User
Cardinale
6/25/2007 9:27 PM
 
Quote



Spazio prenotato per la parte II di "DISCORSI GENERALI CIRCA LA NATURA DEL DNA, IL RUOLO DEL CODICE GENETICO E DELL’INFORMAZIONE EREDITARIA"

[Modificato da Rainboy 25/06/2007 21.29]

OFFLINE
Email User Profile
Post: 3,402
Post: 2,626
Gender: Male
Master User
Cardinale
6/25/2007 9:30 PM
 
Quote

DISCORSI GENERALI CIRCA I FONDAMENTI TEORICI E LE EVIDENZE SCIENTIFICHE DELLA TEORIA DELL'EVOLUZIONE



Il titolo esplicita chiaramente l'argomento di questo articolo: cercherò di spiegare, in modo divulgativo ma non superficiale, gli aspetti più importanti della teoria dell'evoluzione.
La prima parte del discorso è dedicata a spiegare nel dettaglio cosa siano i concetti su cui si fonda la teoria dell'evoluzione; la seconda parte (divisa in due capitoli) è dedicata all'esposizione di varie tipologie di prove su cui si fonda la teoria.
Iniziamo dalle basi:

La teoria dell'evoluzione neo-darwiniana tratta di come la vita si sia sviluppata su questo pianeta, diversificandosi nel corso delle ere fino ad arrivare all'attuale biodiversità. L'ipotesi da cui essa parte è quella dell'origine comune della vita: vale a dire, l'ipotesi secondo cui tutta la vita che osserviamo nell'epoca attuale discende, tramite una fitta rete di antenati comuni, da un singolo organismo progenitore iniziale.
Tale ipotesi nacque come giustificazione necessaria per spiegare le osservazioni inerenti i fossili e la tassonomia in possesso ai naturalisti dei primi anni dell'XIX° secolo ma, come vedremo, ha acquisito nel corso del XX° secolo una quantità di evidenze scientifiche tale da elevare i suoi concetti fondamentali al rango di certezze empiriche; è importante sottolineare che l'evoluzione si estende nell'arco temporale che inizia dall'ipotesi dell'origine comune della vita, e dunque non tratta di come l'organismo progenitore universale sia nato. Quest'ultimo argomento è invece dominio delle teorie dell'abiogenesi, le quali cercano di identificare il modo in cui la materia organica può essersi assemblata per creare forme primordiali di vita. L'argomento della teoria dell'evoluzione invece è come, a partire dalla nascita di tale organismo, sia stato possibile lo sviluppo degli organismi via via più diversificati e complessi di cui abbiamo traccie fossili e paleo-genetiche, fino agli attuali esemplari viventi. E' evidente che i due campi presentano stretti legami e storicamente il contributo dato all'abiogenesi dai progressi del modello evolutivo è stato fondamentale per permettere di circoscrivere il problema dell'abiogenesi nei giusti termini; tuttavia le due teorie sono distinte e non devono essere confuse, anche perché mentre l'abiogenesi si appoggia alle informazioni fornite dalla teoria dell'evoluzione, l'evoluzione è basata su dati e ritrovamenti del tutto indipendenti.

Per spiegare le osservazioni scientifiche e i dati a disposizione dell'uomo sulla vita, la teoria dell'evoluzione si basa su tre differenti concetti chiave. Questi concetti sono:

- La MUTAZIONE CASUALE, teorizzata da Darwin nel 1856
- La SELEZIONE NATURALE, teorizzata da Darwin e formalizzata da Muller nel 1926
- La DERIVA GENETICA, formalizzata da Wright nel 1945

Sebbene le loro definizioni formali siano relativamente semplici, questi concetti non sono facili da inserire nel nostro modo di pensare.


La mutazione casuale è una modificazione imprevista nell'informazione genetica della prole di un individuo. Il gene è un concetto virtuale, che noi usiamo per rappresentare sul piano dell'informazione ereditaria un determinato carattere; si tratta però di una astrazione poiché tecnicamente all'interno del patrimonio genetico di ogni creatura vivente non esistono geni bensì alleli, ossia stringhe di codice che rappresentano ciascuna una possibile versione delle istruzioni da eseguire per un dato gene. Per fare un paragone inerente la biologia classica, si può dire che nell'uomo esiste un gene per il colore dei capelli e per questo gene esiste un allele dei capelli biondi, un allele dei capelli neri, etc. etc.
La mutazione casuale è un evento che può avere molteplici cause di natura chimica; essa investe i singoli alleli, alterando il contenuto informativo delle loro istruzioni e causando quindi la nascita di nuovi alleli, ossia nuove versioni alternative per una stessa istruzione genetica; più raramente, la mutazione casuale è anche artefice o complice di modifiche genetiche tali da creare nuovi caratteri, e quindi nuovi geni.
Inoltre essa ha due caratteristiche fondamentali.
Innanzi tutto è pre-adattativa, ovvero nasce per conto proprio, indipendentemente dalle richieste dell'ambiente. Questo è importante da ricordarsi, perché è controintuitivo: in genere per come siamo abituati a pensare, si tende a supporre che quando si osserva un cambiamento che ha un valore positivo nel contesto ambientale in cui ci si trova, ciò avvenga come conseguenza della necessità che l'organismo aveva di sopravvivere. In altre parole: il "bisongo" conduce all'"adattamento". L'idea che i caratteri ereditari siano in grado di rispondere per conto proprio alle richieste dell'ambiente, anziché emergere su base casuale, è talmente accattivante che fino agli anni '50 del XX secolo anche una forte corrente di evoluzionisti ha favorito una concezione più Lamarckiana (causa-effetto, ripresa dall'originale teoria di Lamarck) del concetto di mutazione casuale: ipotizzava infatti che la mutazione casuale insorgesse in seguito allo stimolo selettivo, e non pre-esistesse ad esso. Per conseguenza essi vedevano ad esempio, in una coltura batterica sottoposta ad agente tossico, che se 1 battere su 10.000 sopravviveva alla tossificazione della coltura, allora l'insorgenza media della mutazione per la resistenza alla tossina X in una coltura di quel dato batterio, è di 1/10.000.
La corrente evoluzionista più darwiniana invece, applicando quello che a posteriori si è visto essere il corretto approccio interpretativo, leggeva quello stesso dato empirico con l'affermazione che il numero medio di mutanti resistenti alla tossina X in una qualsiasi coltura di quel dato batterio, è di 1/10.000.
La disputa fu infine sistemata da un celebre esperimento (test di fluttuazione Luria-Delbruck del 1943) che rispose positivamente alla "sfida" di riuscire a creare un batterio totalmente resistente ad una determinata tossina (sopravvivenza di 10.000 su 10.000), senza che quel batterio avesse mai incontrato in precedenza la tossina in questione, e senza osservare alcun pattern statistico proprio dell'ipotesi lamarckiana. Ciò dimostrò la totale natura pre-adattativa della mutazione casuale, e la portata dell'evento fu tale che gli sperimentatori furono premiati con il Nobel nel 1969. Da quei tempi ad oggi molte altre conferme sono arrivate con l’avvento della biologia molecolare, ma di questo tratteremo più avanti.

In secondo luogo la mutazione casuale ha nel suo secondo termine, la parola "casuale" (random), una forte avversità ideologica, veicolata spesso da un fraintendimento: si scambia infatti il concetto di mutazione casuale per qualcosa che si pretenderebbe essere estranea da ogni influenza causa-effetto. Questo è falso. La biologia non è la meccanica quantistica, non stiamo ragionando sul fatto che degli eventi siano intrinsecamente impredicibili poiché nascono a-causalmente "dal nulla". La nozione di casualità in biologia è soltanto quella di EVENTO NON CORRELATO. Se avessimo tutte le informazioni necessarie, potremmo teoricamente risalire ai dettagli di ognuno dei miliardi di eventi casuali che ha determinato le mutazioni nel genoma della prima cellula nata su questo pianeta, fino a originare la comparsa della nostra specie. Potremmo contare tutti i singoli raggi x che l’hanno ionizzato, tutti gli errori di duplicazione, tutti i mis-pairing delle basi, tutte le tautomerie cheto-enoliche che hanno causato l’insorgenza di mutazioni puntiformi, e così via. Non c'è nessun motivo fisico per cui questo sia impossibile.
E' evidente quindi che qui, quando si parla di casualità in ambito evolutivo ci si riferisce all'impossibilità di prevedere e/o di rintracciare le cause di un dato evento naturale, mentre non si sta invece affermando che queste cause siano prive di un'origine materiale. Essa c'è sempre, a prescindere da quale sia; ma è irrintracciabile e/o irrilevante ai fini del dibattito.


La selezione naturale è l'insieme di circostanze ambientali che agisce come "filtro" adattativo sulla specie, sull’individuo della determinata specie e soprattutto, secondo la teoria ortodossa attualmente supportata, sui geni del singolo individuo (più precisamente, sulla frequenza dei vari alleli per ciascun gene all'interno della popolazione).

La selezione naturale è connessa in modo inestricabile alle richieste ambientali, ossia a ciò che è necessario fare per avere un migliore accesso alle risorse che l'ambiene offre, e per riprodursi con successo.
Thomas Huxley, usò a suo tempo una metafora molto esplicativa per spiegare cosa sia la selezione naturale: disse di immaginare una piantina che fosse capace di sostentarsi con un centimetro quadrato di terreno e di produrre cinquanta semi ogni anno; e di immaginare un mondo in cui, a causa di un clima eccezionalmente florido, un terreno con illimitata fertilità e la totale assenza di predatori, tutte le piantine figlie avessero modo di crescere e maturare nel pieno della loro salute, deponendo un anno dopo la propria nascita i propri cinquanta semi.
Se tali condizioni esistessero sul nostro pianeta, in appena undici anni quella singola piantina avrebbe ricoperto di propri discendenti ogni centimetro quadrato di terre emerse, e avrebbe addirittura ecceduto le possibilità di sostentamento offerte dall'intero globo (4.882.812.500.000.000.000 esemplari prodotti, pari ad almeno altrettanti centimetri quadrati occupati, contro i circa 1.494.000.000.000.000.000 centimetri quadrati ottenibili mettendo insieme la superficie tutte le terre emerse).
La selezione naturale è dunque un modo che noi abbiamo per chiamare collettivamente quell'insieme di fattori che limitano la capacità riproduttiva dei viventi, e li costringono a competere fisicamente per il predominio sulle risorse, nonché su tutto ciò che è necessario per effettuare una riproduzione il più fruttifera possibile.

Bisogna precisare subito un punto: la selezione naturale agisce sul fenotipo di un individuo, non sul suo genotipo. Vale a dire, essa agisce selezionando le caratteristiche materialmente espresse dal mutante nel suo corpo, o nel suo comportamento; non agisce selezionando direttamente gli alleli dei geni coinvolti nel processo. Questo significa, fra l'altro, che una mutazione casuale diventa "visibile" al processo selettivo, soltanto nel momento in cui acquisisce un valore (positivo o negativo) nel fenotipo dell'individuo in cui si trova. Per questo motivo uno stesso vantaggio o svantaggio selettivo potrebbe essere conferito indipendentemente da due mutazioni differenti, che in tal caso sarebbero trattate come se fossero una sola; al contrario, molte mutazioni effettivamente avvenute sul piano genetico, potrebbero situarsi in contesti tali da non avere effetto immediato sul fenotipo, e quindi per lungo tempo potrebbero non interferire con il processo selettivo.

Una frase che è entrata nella mente delle persone come correlata all’evoluzione, è “il più forte sopravvive, il più debole muore”. Si tratta di uno stereotipo molto inesatto, che si presta a interpretazioni prive di legami con la teoria; in realtà, la frase va semmai riformulata in qualcosa del tipo “il più adattato prospera, il meno adattato non prospera”. Questo perché il concetto di "competizione" in ambito evolutivo non deve essere ridotto a una mera serie di lotte fra leoni infuriati, come quelle che i magnifici documentari di Superquark ci hanno spesso fatto vedere. Questa realtà indubbiamente esiste, ma è soltanto uno dei molti aspetti della questione; il discorso, molto più vasto e complesso, è nei termini della capacità di un individuo di generare prole feconda e capace di arrivare al successivo ciclo riproduttivo. L'individuo "vittorioso" infatti è sempre quello che riesce a lasciare dietro di sé un maggior numero di discendenti; saranno in tal modo i suoi geni a passare al ciclo di competizione successiva con un vantaggio numerico, anziché quelli dei rivali. Per sottolineare bene questo aspetto, prendiamo proprio l'esempio dei leoni. Un leone eccezionalmente robusto e aggressivo potrebbe riuscire a mettere in fuga tutti i suoi rivali, conquistandosi un vasto harem di femmine con cui accoppiarsi e un buon territorio di caccia; ma a che pro, se la sua fertilità gli procurerà una prole inferiore per numero o per salute a quella dei rivali che ha sconfitto? Magari perché ha spermatozoi poco vitali, o perché manca dell'istinto di uccidere la prole dei leoni che lo avevano preceduto e concede pertanto alle femmine di spendere molto tempo e risorse per allevare loro; oppure perché per mantenere i suoi muscoli deve mangiare troppo in rapporto alla carne che in quel contesto ambientale può procurarsi, quindi soffre la fame e oltretutto lascia in stato di denutrizione anche le sue femmine. D'altra parte, magari viene surclassato semplicemente perché le leonesse lo vedono come poco attraente e sono più restie ad accoppiarsi con lui di quanto non lo sarebbero con qualche altro maschio.
Per far capire la profondità del meccanismo e la sua universalità, ho preso un esempio dove la competizione fisica è particolarmente incoraggiata e dove quindi caratteristiche come l'essere "forti" restano comunque molto apprezzate; ma tenete presente che spesso non è così. Spesso muscoli e aggressività passano in secondo piano rispetto a fattori come la resistenza alle malattie, la fertilità, l'attrattiva sessuale, la capacità di nutrirsi, i bassi consumi, le facoltà di comunicazione, etc etc.
Difficilmente noi siamo in grado di valutare tutti i fattori coinvolti, ma il ragionamento alla fine è aritmetico: alla successiva generazione facciamo i conti e se una volta tirate le somme dovessimo scoprire che un percettibile vantaggio numerico/prolifico è stato dato ai geni dei competitori "normali" anziché a quelli del leone aggressivo, allora c'è poco da dire: generazione dopo generazione, il perpetuarsi (statisticamente parlando) di questo malus riproduttivo, causerà la graduale scomparsa del patrimonio di costui. Era un individuo non adatto.

Come si vede, i fattori che entrano in gioco nella competizione non hanno valore presi a sé stanti, ma solo in relazione alle necessità ambientali e alle strategie dei rivali. Non ha senso aspettarsi che l’individuo adattato, cioè capace di battere la fecondità dei propri rivali, sia aderente a un modello universale, indipendente dal contesto ambientale. Non conta il fatto in sé che egli nasca più grande o più piccolo, più aggressivo o più docile, più intelligente o più stupido: conta soltanto il risultato finale, cioè che una volta considerate tutte le sue caratteristiche nel contesto ambientale in cui vive, per qualche motivo la sua prolificità sia de facto superiore rispetto a quella dei suoi competitori.
Ciò significa anche che la selezione naturale agisce nel presente e modella il successo riproduttivo dei geni di una specie in modo che essi funzionino qui e ora, senza nessuna forma di "lungimiranza" verso cosa potrebbe servire nel futuro. Non dobbiamo dimenticarlo: non stiamo parlando di un agente intelligente o che possiede dei particolari scopi, ma solo di un meccanismo naturale. Ad esempio la selezione naturale potrebbe spingere verso il perfezionamento di un rozzo apparato foto-recettoriale, destinandolo ad evolversi col tempo in uno splendido occhio, se questo incrementa le chances di sopravvivenza e di conseguente capacità riproduttiva dei mutanti; ma potrebbe benissimo spingere verso la distruzione di questo medesimo occhio qualche milione di anni dopo, se l'ambiente in cui vive la specie adesso è cambiato al punto da rendere più avvantaggiati gli individui ciechi che utilizzano altre facoltà. Questa è una realtà esemplare che si è verificata costantemente in natura con molti organi e strutture corporee, di cui molte specie di animali, soprattutto pesci e artropodi, sono ad oggi testimoni. Ma testimoni lo siamo anche noi uomini, che abbondiamo di strutture vestigiali come la peluria, le vertebre del coccige o l'appendice vermiforme dell'intestino.

Abbiamo già detto, parlando di fecondità (il termine più corretto sarebbe fitness) che stiamo parlando di eventi generazionali, destinati quindi a scale di tempo molto lunghe. Non dobbiamo certo pensare che al verificarsi di un cambiamento di qualche tipo nelle richieste dell'ambiente, nell'arco di una generazione o due la selezione naturale faccia sì che tutti gli individui che non posseggono il carattere X “muoiono”. Questa è un’eventualità che possiamo osservare soltanto in casi davvero estremi, come le colture batteriche di laboratorio. Nella maggior parte dei casi invece l’effetto selettivo si verifica su scala di centinaia di migliaia di anni, quando osserviamo che la frequenza relativa dei discendenti dell’individuo avvantaggiato, supera fino a schiacciare quella dei discendenti dell’individuo non avvantaggiato.
Come accennato prima, è interessante notare che questo fatto si verifica, pur con le debite distinzioni, su ogni scala: anzitutto su scala di geni che competono con altri geni per la compartecipazione alla costruzione degli individui, poi su scala di individui che competono con altri individui per la generazione della prole, ma anche su scala di specie che competono con altre specie per lo sfruttamento delle risorse, e forse anche a livelli superiori. Il punto basilare da cui la teoria osserva gli eventi, resta comunque quello della diffusione degli alleli di un gene nell'ambiente, descritta dalle leggi statistiche della genetica delle popolazioni.
E' evidente che ci aspettiamo che, tanto più degli alleli sono necessari per sopravvivere e riprodursi nell'ambiente (non necessariamente singoli alleli di singoli geni, magari gruppi di alleli per geni diversi che tendono a stare insieme), quanto più essi verrranno conservati nelle generazioni, cioè si potrà osservare un numero elevato di individui che posseggono questi alleli senza mutazioni; viceversa, fra le vaste quantità di alleli non particolarmente necessari e che al momento non conferiscono vantaggi o svantaggi rilevanti, è ragionevole aspettarsi una discreta quantità di mutazioni capaci di lasciare l'organismo vivo e competitivo, quindi ci si può attendere di osservare mutanti vivi e in grado di fornire variabilità genetica alla specie; infine, per quanto riguarda alleli o gruppi di alleli che in qualche attività importante risultano nettamente inferiori nelle prestazioni rispetto ai propri rivali, è logico aspettarsi che debbano tendere a scomparire.
Concludiamo questa parte del nostro ragionamento facendo un esempio concreto: il topo. Questo animale non ha artigli affilati, né corazze chitinose, né un cervello ipertrofico (sebbene l'intelligenza non gli manchi, in relazione alle dimensioni); non sa volare o correre a velocità straordinarie e non possiede sensi superiori a quelli del predatore medio. Eppure, anche mancando di tutto questo, il patrimonio genetico del genere murino è quello di una delle forme di vita più vincenti in assoluto fra i mammiferi. I topi sono antichissimi e sono sopravvissuti con poche alterazioni agli sconvolgimenti più radicali. Come mai questo? E' presto detto; il topo sa occupare nicchie ecologiche che gli altri animali trascurano, e in esse sa adattarsi a prosperare con grande efficienza. I murini posseggono qualità poco appariscenti ma preziosissime nel mondo naturale: sono onnivori, omeotermi, altamente prolifici, sociali e quindi in ultima analisi adattati a sopravvivere in una gamma di condizioni molto flessibile, che ha permesso loro di trovare sempre qualche nicchia da sfruttare nel corso della storia degli ecosistemi. Il loro successo è evidente se pensiamo che, dopotutto, erano molto simili ai topi proprio quei mammiferi che riuscivano a sopravvivere sotto il tacco dei dinosauri, e da cui noi stessi ci siamo distaccati circa 80 milioni di anni fa. Tutto il mondo mammifero odierno conserva vaste porzioni del patrimonio genetico in comune con il genere murino; l'homo sapiens non fa eccezione.

In virtù di quanto detto finora sulla mutazione casuale e sulla selezione naturale, possiamo affermare che l'adattamento di una specie non è mai un processo finalistico mirato ad una integrazione universale, ma un meccanismo cieco (perché pre-adattativo) di conformazione del genotipo alle necessità dell'ambiente attuale; dove per "ambiente" si intende l’intero ecosistema, inclusi predatori, prede, competitori, risorse, clima e così via.
Abbiamo però detto "attuale" perché l'ambiente per sua natura non è una costante. Esso muta e in qualsiasi momento i suoi mutamenti potrebbero manifestarsi in modo sensibile sulla fauna, determinando un'altrettanto brusca variazione delle richieste a cui deve conformarsi il processo di adattamento. Le richieste potrebbero variare semplicemente per imponderabili cause esterne... un caso estremo, ma che rende bene l'idea, è una glaciazione. Oppure potrebbero variare in modo più specifico e sottile, in funzone del fatto che ogni specie, mutando e selezionandosi (cioè, per dirla in termini scientifici, variando significativamente e stabilmente la frequenza degli alleli di un determinato gene all'interno del pool genetico della popolazione), modifica di fatto anche le condizioni in cui vivono le proprie rivali.
Il principio generale è in sostanza che tutto interagisce con tutto; i semplici batteri influiscono in modo sostanziale perfino sul destino dei più imponenti mammiferi; quasi tutti i viventi sono in stretti rapporti gli uni con gli altri, per questo i cambiamenti che compaiono in ogni specie inevitabilmente determinano col tempo dei mutamenti nelle richieste ambientali a cui sottostanno centinaia di altre specie che condividono lo stesso ecosistema.
Questo modo di agire dell'evoluzione spesso è sottile, risulta difficile da interpretare, ma la storia dei viventi su questo pianeta ne è pervasa in ogni sua epoca. La corsa all'adattamento non ha risparmiato niente e nessuno... ogni volta che si è creata una situazione tale per cui le richieste ambientali erano divenute eccessivamente divergenti dalle possibilità adattative di una certa specie, ciò è stata causa della sua estinzione. Parlando in senso metaforico, potremmo dire che l’ecosistema che noi osserviamo e che ci appare così stabile e immutabile, non altro è che la somma degli “stalli” competitivi raggiunti dalle forme di vita attualmente vincenti, ognuna delle quali ha raggiunto un livello di integrazione equivalente alle altre e non riesce in alcun modo a “prevalere” su di esse. Una situazione che è molto meno stabile di quanto crediamo.


La deriva genetica (o deriva genica, a seconda degli autori) è un concetto un po’ più difficile da spiegare, e che spero entri nei nostri futuri ragionamenti in modo limitato per non causare problemi. Wikipedia comunque ci viene in aiuto con un’utile trattazione:

it.wikipedia.org/wiki/Deriva_genetica

Di cui invito alla completa lettura; per brevità qui ricopio il punto saliente:

“In Genetica delle popolazioni, la deriva genetica è l'effetto statistico risultante dall'influenza di una possibilità di manifestazione degli alleli (varianti di un gene). Questo effetto può far divenire un allele e il carattere biologico da esso rappresentato più comune o più raro col passare di generazioni successive. In definitiva la deriva può sia rimuovere l'allele dal pool genetico, sia rimuovere tutte le altre varianti. Dato che la selezione naturale è la tendenza di alleli con effetti positivi a divenire più comuni nel tempo (e di quelli con effetti negativi a divenire meno comuni), la deriva genetica è la tendenza fondamentale di ogni allele di variare casualmente in frequenza nel tempo”.

In pratica, se la selezione naturale è la spinta "ordinatrice" che tende a spostare le frequenze degli alleli verso un maggiore adattamento alle circostanze locali, la deriva genica è una rappresentazione di tutte quelle variazioni casuali che avvengono all'interno del pool genetico, senza riflettere una specifica propensione all'adattamento verso qualcosa.



A RITROSO NEL TEMPO: OSSERVAZIONI MACROSCOPICHE.

Il fenomeno che porta all’evoluzione di una razza in una o più razze con caratteri somatici nettamente differenti da quelli dei propri antenati, destinate poi a perdere l'interfecondità e a trasformarsi pertanto in specie distinte, è definito speciazione o macroevoluzione.
E’ un processo estremamente lento, che viene a formarsi a causa della pressione selettiva (che agisce sul margine di variabilità offerto dalle mutazioni casuali) e della deriva genica; in sostanza, a causa della pressione esercitata dalla selezione naturale, ogni specie tende entro vari gradi ad una lenta evoluzione di caratteri utili a incrementare le proprie chance di sopravvivenza. Nel caso di specie già ben collocate nella propria nicchia ecologica, si tratta in genere di caratteri limitati e “microevolutivi” – un arto più efficace per arrampicarsi, un artiglio un po’ più lungo, un’ala più efficiente. Ma altre volte, e questo è stato vero soprattutto nelle epoche successive alle grandi estinzioni, ci sono state specie che per le nuove condizioni in cui vennero a trovarsi dovettero cercare di adattarsi a nicchie ecologiche molto diverse da quelle dei loro antenati; inevitabilmente questo implicò la selezione di mutanti con caratteri appropriati alla sopravvivenza nelle nuove condizioni… oppure l’estinzione della specie.

Che i fossili possano essere ordinati in una scala coerente con una datazione evoluzionistica, è un fatto noto. Contrariamente a quello che alcuni pensano, in linea generale non è il fossile a definire l’età del terreno, ma il terreno a definire l’età del fossile (salvo casi eccezionali). La paleontologia fa affidamento sulla geologia, per identificare la stratigrafia del terreno in cui è nato il fossile; ne consegue che, se per esempio mettiamo in fila gli scheletri dei mammiferi nati per speciazione dal megazostrodon, una delle specie di “topo preistorico” i cui discendenti originarono tutte le specie mammifere destinate a sopravvivere all’estinzione dei dinosauri, non stiamo stabilendo quell’ordine in un modo che sia comodo a una qualsiasi forma di interpretazione dei fossili, né evoluzionistica né di altro genere: il reperto viene messo in quel punto della linea cronologica perché è lì che lo abbiamo trovato, fine del discorso.
La moderna stratigrafia è inoltre stata affiancata da metodi capaci di fornire datazioni assolute, come la misurazione degli isotopi radioattivi. Le tecniche sono ormai raffinate e vengono usate in concomitanza fra loro per raggiungere verdetti attendibili; nulla è immune da errori naturalmente, ma come sempre, noi stiamo guardando l’aspetto statistico e non i singoli casi: sbagliare la datazione stratigrafica di un fossile di gallimimus del Cretaceo è possibile, sbagliare quella di tutti i suoi i fossili rinvenuti sul globo risulta decisamente meno probabile.
I fossili sono una prima e importantissima verifica che sostenne, già ai tempi di Darwin, la teoria dell’evoluzione: quasi tutti sono coerenti con i lenti e costanti cambiamenti evolutivi teorizzati dalla moderna visione scientifica. In alcuni casi, come in quello “recente” dell’uomo, ai giorni nostri abbiamo ricche documentazioni fossili (e a volte perfino non-fossili) che riportano di specie e sottospecie straordinariamente aderenti al nostro sviluppo fisico: la stazione eretta, il pollice opponibile, lo sviluppo del cranio, del bacino, della mandibola, della colonna vertebrale e degli arti sono caratteri estremamente ricchi di informazioni, solo per dirne alcuni dei principali. La comunità scientifica ormai non ha dubbio alcuno sull’evoluzione dell’uomo per speciazione da alcune varietà di quei primati da cui discendono anche le moderne scimmie; i dibattiti, anche quelli più accesi, riguardano il come, non il se. Come per ogni campo del sapere anche qui esistono ancora degli scettici, seppure al giorno d'oggi siano ormai pochi e generalmente privi di titoli di studio sulla materia. Essi sostengono obiezioni di varia natura, di solito imperniate su temi ricorrenti: “i tempi sono troppo ristretti”, “la comparsa di questo determinato carattere non è spiegata in modo attendibile”, “manca questo determinato anello di congiunzione” e così via. Il dibattito scientifico di per sé vive di critiche, ma ogni persona assennata sa che una critica per avere senso deve essere circoscritta al proprio contesto; l’incoerenza di una determinata datazione fossile con una determinata ipotesi evolutiva, lungi dall'essere impossibile, implica la necessità di rivedere le stime fatte in base a quell’ipotesi... non implica invece la necessità di demolire i suffragi che le ultime decine di migliaia di reperti avevano fornito al modello globale, negli ultimi centocinquant’anni di storia.
Ai giorni attuali, le moderne scoperte della paleoantropologia ci hanno permesso di ricostruire un albero filogenetico della razza umana ormai abbastanza dettagliato, soprattutto grazie all’apporto della biologia molecolare; grazie alle nuove tecniche che essa ci ha procurato, è stato possibile individuare molti inediti "pattern" di somiglianza genetica fra le specie primati, vale a dire molte rassomiglianze che non sono espresse esteriormente, ma compaiono solo analizzando i dettagli genetici delle specie; forti di queste acquisizioni, gli studiosi sono riusciti a racchiudere le specie attualmente note in un quadro molto coerente, dove la plausibilità di ogni tassello non si basa soltanto su collocazioni assolute nello spazio e nel tempo, ma è anche rafforzata dalla capacità reciproca degli altri tasselli di spiegarne in modo credibile la provenienza e la storia.
La ricerca è tutt'altro che conclusa, sia chiaro. Spiegare perché una cosa sia andata in un modo invece che in un altro fra tutti quelli possibili, è proprio la sfida che gli scienziati affrontano ogni giorno; ci si scontra ogni volta con la consapevolezza che il fatto che non si possegga ancora un fossile della specie X, non è motivo sufficente per ritenere che tale specie non sia mai esistita; o un’insolita discrepanza in un dato osso fra gli antenati e i discendenti di quella specie, pur uscendo dalle previsioni, non può considerarsi motivo serio per dubitare della loro parentela, quando fra gli altri duecento c'è una buona compatibilità e i dati paleogeografici sull’ambiente ci fanno ipotizzare la loro continuità. Bisogna accettarlo: l’evoluzione non è un processo prevedibile, il suo “motore” selettivo può avere le più disparate velocità e può esprimersi nei più svariati modi, a seconda delle condizioni ambientali in cui si trova una determinata specie e della sua capacità di adattamento. Noi non abbiamo la macchina del tempo, non possiamo sapere esattamente cosa sia successo e perché. Inoltre le nostre semplificazioni non devono trarci in inganno: ci sono effetti di grande potenza e scarsa prevedibilità, che possono plasmare i rapporti di ogni specie con l'ambiente. Per esempio la deriva genica di popolazioni isolate, che nei casi estremi diventa il cosiddetto “effetto del fondatore”: cioè una situazione in cui pochi individui distaccatisi da una popolazione migrano e raggiungendo un nuovo territorio fertile, ricostruiscono di fatto una popolazione analoga a quella da cui inizialmente provenivano, ma con dei rapporti numerici fortemente squilibrati fra i vari alleli del pool genetico... appunto perché le proporzioni della nuova colonia derivano dagli assortimenti casuali posseduti dai fondatori, che non erano certo per necessità un campione fedele delle originali distribuzioni alleliche della specie.
L'impatto di simili fenomeni può essere molto forte. I biologi ritengono che situazioni simili abbiano favorito innumerevoli speciazioni nel corso delle ere passate; del resto non è un mistero il fatto che il ritmo con cui delle specie opportunamente segregate si adattano all’ambiente, possa avere velocità molto elevate e portare a soluzioni in breve tempo divergenti fra loro. Basti pensare ai fringuelli delle Galapagos studiati da Darwin, che ancora oggi, decennio dopo decennio, continuano ad evolvere su ogni isola le varietà dei loro becchi, sotto gli occhi ammirati degli ornitologi!

In definitiva si può dire che gli interrogativi di cui i creazionisti si fregiano come fossero prove, a volte (in verità piuttosto spesso) sono falsi o vetusti, ma altre volte sono invece dei punti di domanda ben noti nel panorama della biologia moderna, preziosi per spingere in avanti la nostra ricerca di risposte.


A RITROSO NEL TEMPO: OSSERVAZIONI MICROSCOPICHE.

La biologia molecolare è uno strumento che il povero Darwin nemmeno si sognava. La cosa sorprendente è che in effetti, le conferme più schiaccianti dell’evoluzione biologica sono arrivate proprio dall’infinitamente piccolo; insomma se già un naturalista dell’800 poteva argomentare che le stesse strutture biologiche erano ricorrenti in molte forme di vita simili, o che determinate rassomiglianze sembravano occorrere un po’ dappertutto in una determinata classe di esseri viventi, allora che cosa dovrebbe dire un moderno biologo molecolare, che si trova davanti alla sconcertante realtà che TUTTI gli esseri viventi posseggono una molecola di trasmissione dell’informazione ereditaria universale, costruita con gli stessi componenti e usata nel medesimo modo? Non sembra già soltanto questo dato basilare, un indizio di incredibile portata a favore di una comune parentela?
Bisogna tenere presente che ogni discorso finalistico qui non ha ragione d'essere; non ci sono motivi a priori per pensare che l'acido desossiribonucleico debba essere il sistema privilegiato per trasmettere l'informazione, e nessuno dei suoi componenti possiede qualità uniche o tali da renderlo irrinunciabile. Tanto è vero che inizialmente, gli scienziati avevano pensato fosse più logico aspettarsi che l'informazione ereditaria fosse trasportata da una grande varietà di proteine, piuttosto che da un "semplice" polimero come questo.
Entrando più nello specifico, le osservazioni si sprecano. L'unità strutturale del DNA e dell'RNA è il nucleotide, un aggregato di tre distinte molecole: una base azotata fra quattro possibili scelte, nello specifico Adenina, Timina, Citosina, Guanina (nell'RNA l'Uracile sostituisce la Timina), legata ad uno zucchero furanosico (il ribosio per l'RNA, il desossiribosio per il DNA) e ad un gruppo fosforo, cioè un atomo di fosforo circondato da quattro atomi di ossigeno. Il nucleotide è una molecola universale: tutti i viventi utilizzano questo costrutto, senza eccezioni, e lo assemblano per farci un DNA strutturalmente uguale. Una cosa davvero assurda sul piano delle probabilità: le basi azotate possibili sono centinaia se non di più, perché delle specie non direttamente imparentate dovrebbero usare soltanto le stesse cinque? Tra l'altro non appaiono scelte con gran criterio: non sono le più utili, tanto è vero che nel corso dell’evoluzione delle specie eucarioti, Guanina e Citosina sono state progressivamente messe in minoranza da Adenina e Timina per motivi di efficienza meccanica, e il nostro attuale patrimonio genetico è ben lontano dall’essere scritto con caratteri “fifty-fifty” fra le coppie AT/TA e CG/CG, come si osserva invece nei genomi di esseri procarioti che hanno conservato i vecchi sistemi.
Facciamo altri esempi. Se gli zuccheri ad anello furanosico (cioè a forma di pentagono chiuso) più comuni sono dozzine, perché ogni specie avrebbe dovuto mettersi ad usare sempre e solo l'accoppiata ribosio/desossiribosio? E poi se guardiamo al modo in cui vengono tradotte le informazioni genetiche, non si può evitare di osservare che fra i milioni di amminoacidi possibili secondo le regole della chimica organica, tutti i viventi ne hanno usati soltanto una ventina per costruire le loro proteine, guarda caso gli stessi per tutti.
Ormai credo che il concetto sia chiaro, quindi invece di continuare a citare "coincidenze", come volendo si potrebbe fare ancora a lungo, termino menzionando un'ultima osservazione: l’interpretazione del codice genetico, ossia la corrispondenza a triplette che intercorre fra tre basi azotate e un amminoacido (permettendo così la traduzione del codice nei suoi prodotti finali, cioè le proteine) è un codice del tutto arbitrario; ogni forma vivente potrebbe avere un proprio codice e questo dovrebbe essere, se non proprio casuale, almeno scelto fra un vasto campionario di molti milioni di combinazioni possibili in base alla compatibilità degli elementi chimici. Non si scappa: è come con il codice morse, in cui ogni lettera dell'alfabeto deve essere codificata da una serie di punti e linee, ma non esiste alcun motivo per preferire la combinazione (S = ...) piuttosto che (S = ---) oppure (S = -.-) o qualsiasi altra opzione.
Invece il codice genetico si conserva quasi uguale a sé stesso, con alcune minime variazioni locali, fra tutte le specie viventi conosciute. Anche il linguaggio con cui questo codice viene razionalizzato, o per dirla in un altro modo la "sintassi" con cui vengono assemblate le "frasi" sul DNA, è basata su regole ampiamente condivise fra i viventi e traccia un lungo sentiero che imparenta per gradi tutte le forme di vita di questo pianeta, dai più semplici batteri procarioti ai più complessi mammiferi.

Osservazioni come queste, effettuate dalla nascente branca della biologia molecolare nel corso degli anni '60 e '70 (la forma del DNA fu scoperta solo nel 1953), dimostravano l'origine comune della vita da una prospettiva rivoluzionaria, inserendosi un contesto molto favorevole. In quei decenni la geologia stava perfezionando i dettagli della teoria della tettonica delle placche, legittimando i tempi eonici e le collocazioni geografiche del processo evolutivo; la biologia tradizionale procedeva nelle osservazioni documentate su vasta scala della mutazione casuale e della selezione naturale sugli organismi contemporanei, dai batteri alle falene, dai fringuelli alle tartarughe marine e ai gabbiani; la tassonomia sistematica inoltre aveva schedato ormai migliaia di specie in famiglie compatibili con il modello teorico; l'anatomia comparata aveva documentato una vasta serie di vestigia anatomiche spiegabili solo con l'ipotesi evolutiva; infine i continui ritrovamenti fossili seguitavano a spalleggiare l’idea di Darwin sul modo specifico in cui, a partire dalle origini, si fosse poi storicamente generata la biodiversità attuale. Il quadro stava quindi facendo molti passi significativi verso la completezza formale.
A onor del vero, nell’epoca in cui queste conferme vennero fuori ormai già quasi nessun accademico dubitava più della veridicità dei pilastri della teoria dell’evoluzione, ma questo a causa di motivi storici: erano state fatte delle importanti sperimentazioni ab absurdum, come il già citato esperimento Luria-Delbruck, che avevano mostrato il profilo pre-adattativo della mutazione casuale, falsificando l’unica teoria rivale a quel tempo reputata credibile.
Insomma: giunti negli anni ’60, chiusi definitivamente i conti con il lamarckismo e il creazionismo, la certezza logica ed empirica era già fortissima. Tuttavia, perché diventasse totale mancava ancora la “benedizione” alla teoria, impartita dal mondo microscopico. Esisteva o no un modo per osservare gli effetti reali della mutazione, della selezione e della deriva DIRETTAMENTE nel patrimonio genetico e citologico delle varie specie?

La risposta fu un clamoroso “sì”.
Quando si iniziò ad entrare nel regno della cellula, tutto assunse gradualmente un significato evolutivo di grande evidenza; molte cose che secondo schemi logici in cerca di un ordine "prestabilito" non avrebbero mai avuto senso, diventarono lampanti se si provava ad immaginare come avrebbero potuto formarsi a partire da strutture più semplici e aspecifiche.
Ci sono dettagli in cui non posso entrare, perché trascenderebbero il carattere divulgativo di questo articolo. Ma dal punto di vista citologico voglio ugualmente evidenziare un’acquisizione che reputo il coronamento, o almeno l’episodio più bello che mi viene in mente, nella ricerca delle tracce dell’evoluzione nella cellula.
Fu comprovata l'osservazione che il mitocondrio, l’organulo deputato alla respirazione cellulare, non sembrava essere una struttura nativa delle nostre cellule primordiali, ma piuttosto il discendente di un batterio procariote che si era fuso simbioticamente ad esse nel corso dei milioni di anni. Aveva caratteristiche decisamente fuori dall’ordinario: innanzi tutto un DNA proprio, scritto con un sistema di codifica delle informazioni differente da quello eucariote (anche se la chiave di lettura delle triplette era uguale); e poi aveva i propri ribosomi, anch’essi stranamente più simili a quelli di un batterio che ai nostri, quindi produceva per conto proprio alcune delle sue proteine essenziali; inoltre conservava una propria membrana e ne controllava l’integrità. La cosa forse più impressionante, era che questo organulo manteneva una parziale autonomia decisionale nelle questioni inerenti la riproduzione: quando la cellula eucariote intendeva dividersi, non duplicava i mitocondri come fossero una qualsiasi struttura rimpiazzabile, bensì attendeva che fossero loro a crescere fino al momento in cui optavano per una scissione.
Oggi siamo arrivati alla stupefacente conclusione che molto probabilmente noi, così come ogni altra specie eucariote sul pianeta (piante, animali, funghi, protozoi) siamo nati dalla somma dell’attività di due, o forse più organismi arcaici, raggruppati in una sola forma di vita.
E’ stato così, da quella prima specie simbiotica, che sono nati i prototipi delle moderne cellule eucarioti: le quali furono in assoluto le prime forme di vita abbastanza sofisticate da trovare vantaggioso lo sviluppo di una reciproca collaborazione societaria.
Grazie ad esse e alla loro cooperazione sono poi nati i primi organismi pluricellulari, ed è stato possibile iniziare la conquista del mondo "macroscopico" che ci circonda.
Senza quel fortunato evento, forse oggi la Terra sarebbe popolata soltanto da immense quantità di batteri.

Ma non divaghiamo, anche perché sull'informazione genetica c'è ancora molto da dire. Gli evoluzionisti degli anni '50 e ’60 erano ancora pionieri che si servivano degli scarsi mezzi tecnologici a disposizione all’epoca, per cercare conferme genetiche dell’evoluzione, analizzando il patrimonio genetico di cellule appartenenti a molte specie uni e pluricellulari. La "biologia molecolare" era praticamente nata con il lavoro del '53 di Watson-Crick-Franklin-Wilkins sul DNA; il suo contributo alla teoria neodarwiniana, già enorme fin dal principio, crebbe con l'evolversi della tecnologia e lo sviluppo di tecniche mirate al sequenziamento del genoma. Infatti sequenziando, cioè ricavando la sequenza bruta dei caratteri delle stringhe di DNA e interpretandone poi le informazioni contenute, negli anni i genetisti trovarono parentele evolutive che rasentavano l’inverosimile, superando di gran lunga le aspettative del più fanatico fra i sostenitori dell’origine comune della vita.
Di nuovo devo mettere le mani avanti: elencare il numero di prove che venne fuori nei decenni successivi è assolutamente fuori dalla mia portata, sia per la quantità che per la complessità degli esperimenti e delle dimostrazioni. Dal canto mio, voglio però scegliere alcune delle “chicche” più spettacolari emerse nell’era del sequenziamento dei genomi, e riportarvele qui al meglio delle mie capacità, corredate degli appropriati ragionamenti di cui costituiscono le prove scientifiche.


SEMPLICI PROVE BIOMOLECOLARI DELL’EVOLUZIONE

Sapete perché il topo è usatissimo nelle sperimentazioni mediche e farmacologiche? Non solo perché il suo allevamento è economico, cosa che comunque non guasta; e neanche soltanto perché è prolifico e ha un rapido ricambio generazionale, altra cosa che pure è di grande utilità; bensì perché, attenti alla cifra… il 98% dei suoi geni sono esattamente quelli del patrimonio della specie umana. Sono perfino disposti su cromosomi simili nei rispettivi cariotipi, il che significa che sono raggruppati secondo sequenze perlopiù analoghe.
Tutto ciò rende questo animale l’organismo fisiologicamente più simile a noi dopo i primati, e quindi un eccellente modello semplificato del corpo umano; addirittura, mi è capitato una volta il privilegio di assistere personalmente nei laboratori del S.Raffaele all’opera di valenti ricercatori di base che erano in grado, studiando i dettagli nelle interazioni molecolari sulla superficie della membrana delle cellule di Schwann e su quella dei neuroni del topo, di formulare teorie utili per predire le analoghe interazioni esistenti fra le cellule di Schwann e i neuroni dell’uomo.

Ora, anche trascurando le già citate parentele chimiche e molecolari che accomunano tutti gli esseri viventi nei loro componenti fondamentali, voglio farvi presente quale è la loro parentela a livello informativo: insomma, il motivo pratico per cui il topo avrebbe potuto essere quello che è, anche avendo un patrimonio genetico totalmente diverso da quello umano, come avremmo ragionevolmente dovuto aspettarci se questa forma di vita non fosse nata per speciazione da un antenato comune alla nostra razza.

Dobbiamo ricordarci che un gene codifica per la sintesi di una proteina**, e una proteina esiste unicamente per acquisire una determinata forma che sia utile al ruolo affidatole dall’organismo; la forma molecolare (gli elmenti chimici giusti disposti spazialmente nelle corrette conformazioni) è infatti il requisito indispensabile per il ruolo enzimatico che tale proteina svolge a livello chimico, o per il ruolo statico che essa possiede nelle strutture di sostegno dell’organismo. Esistono molte specie biologiche che si sono trovate a dover affrontare le stesse sfide metaboliche, e hanno sviluppato proteine aventi specializzazioni analoghe. Per esempio trasportare l'ossigeno è un compito relativamente facile, ma fondamentale; è logico aspettarsi che anche un topo, una pecora o qualsiasi altro animale abbia bisogno di un'emoglobina... un trasportatore specializzato, insomma.
In effetti la pecora (prendiamo lei che ci farà comodo) questo trasportatore ce l'ha, e se non è proprio uguale a quello dell'uomo, è almeno molto simile... così come tutto il sangue di pecora è simile al sangue umano, tanto è vero che la prima trasfusione di sangue mai tentata, quasi cinque secoli or sono, fu da pecora a uomo e non fu letale per l’individuo.
Tuttavia tali analogie chimiche fra le proteine non erano assolutamente NECESSARIE. Questo è il punto. Perché se è vero che la forma è fondamentale per la funzione, è errato pensare che esista un solo sistema possibile per ottenere una determinata forma, o che una sola forma sia correlata ad una funzione. Sarebbe possibile costruire al computer (o nella realtà, facendo uso dell'ingegneria genetica) un’emoglobina perfettamente funzionale per il metabolismo della pecora (o del topo, del cavallo, etc.), capace di fare le stesse identiche cose e di assumere una forma molto simile, restando comunque significativamente differente nella sequenza dei suoi amminoacidi da qualsiasi gene emoglobinico dei mammiferi. Basterebbe prendere uno ad uno tutti i domini, cioè le unità funzionali della proteina, e riprogettarli con catene coerenti e capaci di svolgere il proprio ruolo. Cosa che riportata con gli opportuni aggiustamenti sul DNA, equivarrebbe a una striscia di codice del tutto diversa.
Ne consegue che se ipoteticamente ognuno dei circa 22.000 geni che il topo condivide con noi non fosse stato originato da piccole variazioni di un gene arcaico che possedevamo entrambi, allora in seguito ad un’evoluzione separata non avrebbe avuto alcun motivo pratico per essere uguale al suo omologo umano. La proteina per cui esso codificava avrebbe avuto mille altre possibilità di assolvere al proprio ruolo, usando sequenze differenti e perfino conformazioni spaziali differenti per raggiungere il medesimo scopo. Figuriamoci poi, se per ipotesi fosse stato costruito in base ad interventi “intelligenti”.
Chiarito questo punto, le somme si possono tirare facilmente: una similarità del 98% implica un’analogia perfetta (entro i limiti delle singole mutazioni individuali e razziali) nel confronto comparato di sequenze lunghe centinaia di milioni di basi azotate. E' una coincidenza impossibile da un punto di vista casuale e illogica dal punto di vista causale… a meno che non ci sia stato un antenato comune, dal quale abbiamo mutuato tale eredità genetica. Con il senno di poi, cioè di chi possiede queste conoscenze ignote all'epoca di Darwin, si tratta di una semplice e banale deduzione logica.

Il genoma umano e quello murino sono stati completamente sequenziati, ragion per cui sono pieni di geni che presentano questo tipo di somiglianze. Ma è interessante notare che in moltissimi animali per i quali il sequenziamento è incompleto, si notano analogie simili, secondo vari livelli di parentela. E questi livelli guarda caso coincidono in modo sorprendente con quelli della tassonomia già ammessa da Darwin e basata sulla versione originale di Linneo: ad esempio l’emoglobina di pollo è praticamente identica a quella del tacchino (di cui condivide il genere), mentre ha discrete differenze con quella del cavallo (di cui condivide la classe ma non il genere); differenze comunque molto meno evidenti di quelle che ha con l’emoglobina dello squalo (di cui condivide il phylum ma non la classe), e così via. Nessuna di queste emoglobine aveva motivo pratico per mostrare rassomiglianze con le sue omologhe di altre specie, oltretutto secondo dei precisi schemi di progressiva differenziazione in base alla classificazione tassonomica, se non fosse esistito un LUCA, ovvero un Last Unique Common Ancestor, che univa fra loro il pollo e il tacchino; e anche un LUCA che collegava, più indietro nel tempo, il pollo con il cavallo. E un LUCA ancor più anteriore che collegava gli antenati del pollo con quelli dello squalo, fino ad arrivare ad un LUCA che è comune a tutte le specie del regno animale.
Da notare che questo ragionamento può e deve essere generalizzato: ho parlato di emoglobine soltanto perché sono proteine antiche e dotate di un tasso di mutazioni mediano, perfetto per il nostro esempio; potevo però citare migliaia di altre proteine aderenti a tale schema di classificazione, ognuna con una propria velocità strettamente correlata al proprio ruolo biologico. Ci sono molte dimostrazioni basate su osservazioni analoghe a quelle trattate qui, che ci permettono di ricollegare con altrettanta solidità il regno animale con gli altri regni, come quello vegetale o quello fungino.
In definitiva che cosa vogliamo fare, quindi? Se neghiamo la comune parentela, dimostrata storicamente dai fossili e biologicamente dalla nostra stessa natura di esseri viventi... come giustifichiamo queste bizzarrie?
Lo conoscete il principio del rasoio di Occam, suppongo.

1) Entia non sunt multiplicanda praeter necessitatem. (gli enti non devono essere moltiplicati dove non sia necessario)
2) Pluralitas non est ponenda sine necessitate. (la pluralità non deve essere ipotizzata senza necessità)
3) Frustra fit per plura quod fieri potest per pauciora. (è inutile fare con molto ciò che si può fare con poco)





* = quest’ultimo capoverso in realtà meriterebbe un approfondimento, e cioè il concetto di E.S.S., sigla traducibile in “strategia evolutivamente stabile”, coniata da Richard Dawkins e divulgata nel suo libro “Il gene egoista”. Il concetto di E.S.S. è oggi una singolare chiave interpretativa, sia matematica sia concettuale, della biologia evoluzionistica moderna, che ha acceso vivaci controversie nel mondo accademico. L’E.S.S. inserisce fra l’altro alcuni aspetti della teoria dei giochi nel neodarwinismo, per gettare un ponte di collegamento fra il concetto di selezione naturale e quello di deriva genetica; tuttavia questo, meriterebbe studi approfonditi da parte degli interessati. Qui dobbiamo rimandarne la trattazione.

** = salvo casi molto particolari che qui non tratteremo; la maggior parte dei geni codifica per proteine, ma ci sono anche geni la cui funzione primaria è la sola trascrizione in RNA, senza la traduzione e la sintesi proteica. Ciò non intacca la validità del ragionamento che segue nel paragrafo: anzi, una variante molto simile potrebbe essere applicata proprio a loro.

[Edited by Rainboy 12/23/2010 9:12 PM]
Admin Thread: | Close | Move | Delete | Modify | Email Notification Previous page | 1 | Next page
New Thread
Reply

Feed | Forum | Album | Users | Search | Log In | Register | Admin
Create your free community and forum! Register to FreeForumZone
FreeForumZone [v.6.0] - Leggendo la pagina si accettano regolamento e privacy
Tutti gli orari sono GMT+01:00. Adesso sono le 11:39 PM. : Printable | Mobile
Copyright © 2000-2021 FFZ srl - www.freeforumzone.com